×


عدنان ابراهيم والتطور

12246605_535204559974736_6352460723948938859_n



#منكوشات_تطورية – عدنان إبراهيم مجرد ناقل للشبهات بذمة وضمير !! هل بالفعل تتشابه جينات الإنسان والشيمبانزي بنسبة 98.5% ؟؟

هل تعلمون ذلك الشخص الذي يبحث عن التميز والاختلاف بأي ثمن وبأي طريقة حتى ولو على سبيل (خالف تعرف) ؟! هل تعلمون ذلك الشخص الذي يبحث وينقب عن كل غريب وشاذ من الأفكار لـ (يصطاده) ويعرضه على الناس وكأنه أتى بما لم يأت به أحد أو بما لم ينتبه إليه أحد : وفي الحقيقة ما هو إلا حاطب بليل (يعني مجرد ناقل من غيره) ؟!

فللأسف الشديد – وبعد إثارته الفتنة والبلبة والطعن في الصحابة وأكابر العلماء والسُـنة والأحاديث وتشكيك الشباب دينيا – : انتقل عدنان إبراهيم منذ فترة إلى (مجال جديد) وهو المجال (العلمي) ليُبدع فيه ويترك بصمته (التنويرية) كما فعل في (الدين) من قبله !!

المشكلة هنا أنه لا ولم يكتفي بمجرد (النقل) فقط وما لقنه إياه الدكتور عمرو شريف للأسف بعد لقائهما معا في القاهرة – ولكن المشكلة أنه (يتقمص) ويُلقي الشبهات التطورية بكل (ذمة) و (ضمير) رغم نسف العلم لها منذ سنوات وإلى اليوم !!

فبعدما فضحنا جهله من قبل في خرافة (التآسل الرجعي) ورأينا معا كيف (تعجبت) صفحة تطورية نفسها مما قاله عن ظهور (قرون) لبعض البشر كدليل على التاريخ التطوري من الحيوانات (وما كانت إلا مرض يصيب الخلايا في الرأس) !!

وكما عرضنا عليكم كذلك ردودا مختلفة – ولا زلنا – على الكثير من الأعضاء التي ينقل التطوريون – ومعهم عدنان – للمسلمين البسطاء والشباب للأسف أنها فيها (أخطاء في التصميم) !!! ضاربا بعرض الحائط ما تحدى به الله عز وجل العالمين في القرآن من كمال صنعه وإتقانه : ” صنع الله الذي أتقن كل شيء ” أو كمال تقديره الذي لا يترك عضوا بلا فائدة فضلا عن خلقه بلا فائدة : ” إنا كل شيء خلقناه بقدر ”

فاليوم بإذن الله تعالى نتعرض لأشهر مقولة على لسان جهلة التطوريين وأكابرهم على السواء وهي :
تشابه جينات الإنسان والشيمبانزي بنسبة 98.5 %
فهل هذا الكلام صحيح ؟
——————-

1))
ما هو الحمض النووي أصلا وما هي الجينات ؟؟

الحمض النووي الوراثي أو DNA في الخلايا الحية وفي كل خلية من خلايا الإنسان الحية : هو شريط طويل من القواعد (أكثر من 3 مليار قاعدة) في نواة كل خلية – حيث تمثل كل قاعدة مع ما يرتبط بها اسم (نيوكلوتيدة) – وهذه القواعد الكثيرة جدا مرتبة في شكل لغة برمجة أو كتاب ولكن من 4 حروف فقط يُرمز لهم بالقواعد الأربعة (A T G C) – فمثلا نجد ترتيبا مثل الآتي كلغة الشفرة تماما :
ATTAGATCCAATATCAGGCCTACGACCTGGTCAGTCAGAAT

حيث يمثل كل حرف منهم كما قلنا : قاعدة – وكل بضع مئات منهم أو آلاف يمثلون (جين) حيث الهدف من هذا الحمض النووي الوراثي : هو تكوين (البروتينات) التي تعطي كل صفات الخلايا الحية المختلفة : حيث كل مجموعة كبيرة أو صغيرة من هذه القواعد كما قلنا تسمى (جينات) وكل جين مختص بتكوين (بروتين) معين أو أكثر – والبروتينات هي التي تعطي كل صفات جسم أي كائن حي – فالشعر مثلا يكونه بروتين – وكذلك قرنية العين – وأيضا الأظافر – والبروتينات تدخل كذلك في تكوين العضلات وفي سائر أعضاء الجسم بل وفي تركيب الخلية الحية نفسها الصغيرة جدا يعتبر ثلثيها بروتينات – والسؤال :

هل ((كل)) شريط الحمض النووي أو بمعنى آخر هل ((كل)) الـ 3 مليار قاعدة مثلا كما في الإنسان : يُستخدمون جميعا في عمل بروتينات ؟؟
والإجابة : لا

بل جزء صغير جدا من هذا العدد الهائل (قرابة 5 %) هو الذي يحمل شفرات تكوين البروتينات التي تعطي صفات الكائن الحي – وأما الجزء الأكبر فلم يُعرف وظيفته إلى وقت قريب (حيث كان يعتبره التطوريون خردة Junk Gene وبلا وظيفة كعادتهم في الاستدلال بالجهل !!) إلى أن اكتشف العلماء أنه كله له وظائف تنظيمية هامة جدا لعمل الحمض ككل وضبط عمليات نسخ الحمض النووي المشفر أو الجينات : متى وأين وكيف إلخ

إذن هنا ملحوظة هامة وهي سبب تلك المقدمة ألا وهي :
أنه من الطبيعي جدا (جدا جدا) أن يوجد تشابه بين كل الكائنات الحية في جزء كبير من حمضها النووي الوراثي – إما تشابه في الجزء الكبير المختص بتنظيم عمليات النسخ والتحكم فيها وضبطها (لأنها وظائف عامة تقع في كل الكائنات) : وإما لتشابه بعض الجينات بالفعل والمختصة بصفات مشتركة أو متقاربة في الكائنات الحية – وهو ما يؤكد (الخالق الواحد) أو ما يسمونه في الخارج بـ (التصميم المشترك) common design مثل وجود صفة استخدام الموجات الصوتية كالسونار لتوجيه الحركة في كل من الخفاش والحيتان !!

والشاهد : أن وقوع التشابه في الحمض النووي بين الإنسان وغيره من الكائنات (حتى النباتات والفاكهة والحشرات وليس الشيمبانزي فقط) هو شيء عادي جدا وخصوصا أنهم يتغذون على بعضهم في سلاسل الغذاء المعروفة : وذلك لم يكن إلا إذا كانت أجسامهم تحتوي على نسب كبيرة مشتركة التكوين بينها من البروتينات وغيرها
ويتبقى الجزء الأصغر فقط في البروتينات هو الذي يحمل الفروقات والتميز بين كل كائن وآخر أو كل نوع وآخر
—————

2))
ونبدأ الآن مع أولى الصدمات للتطوريين :
دراسة جديدة تؤكد وجود 80 % من الاختلافات بين بروتينات الشيمبانزي والإنسان !!
Eighty percent of proteins are different between humans and chimpanzees.
المصدر :
https://www.ncbi.nlm.nih.gov/pubmed/15716009

وهذا يعني عددا هائلا جدا من الاختلافات بين الإنسان والشيمبانزي بطبيعة الحال لأنه كما قلنا البروتينات هي الحاملة لصفات وتميز كل كائن حي عن الآخر !!
والسؤال الآن وأمام هذه النسبة الكبيرة من الاختلاف :
إذن من أين جاء التطوريون بأضحوكة تشابه جينات الإنسان والشيمبانزي بنسبة 98.5% ؟؟
—————–

3))
لكي تكتمل أركان هذه (الأضحوكة) فعلا وتلمسوا بأنفسكم مدى الاستهتار والاستخفاف التطوري بالناس وغير المختصين :

فيجب أن تعلموا أن مشروع فك شفرة الجينوم البشري بأكمله لم ينتهي أصلا إلا في 2001 بعد أن استغرق قرابة 10 سنوات كاملة !!!
فقارنوا ذلك الآن بالمعلومة الهزلية التالية وكيف نشأت :

حيث في عام 1987م !!! – يعني قبل 14 سنة من فك شفرة جينوم الإنسان كاملة !! – قام الباحثان (التطوريان) سيبلي Sibley وألكوست Ahlquist بدراسة 30 إلى 40 بروتين فقط في الشمبانزي ومقارنتها بتلك الموجودة في الإنسان (مع العلم أن في جسم الإنسان أكثر من 100 ألف بروتينمعروفين إلى الآن ويتزايدون) أو بمعنى آخر فقد قاما بدراسة ما نسبته 1 إلى 2500 من البروتينات في الإنسان – فماذا خرجا ؟؟

خرجا بنتيجتهما المتحيزة بالطبع وغير علمية ولا حيادية – والتي لم تتزعزع من ساعتها وإلى اليوم في الأوساط الداروينية والإلحادية يكررونها كالببغاء وفي الإعلام – وهي :

أن نسبة التشابه في الجينات بين الإنسان والشيمبانزي هي 98.5 % !! هكذا بكل إطلاق وبتعميم مخادع كذوب وكأنهم درسوا كل بروتينات جسم الإنسان !!

وعلى الفور قاما بنشر بحثهما في مجلة تطورية شهيرة !!
المصدر :
Sibley and Ahlquist, Journal of Molecular Evolution, vol. 26, pp. 99-121

وأما المفاجأة : فهي أن التجربة التي استخدمها الاثنان هي تجربة قليلة الاستخدام أصلا ومثيرة للجدل لعدم دقة نتائجها !! ألا وهي تجربة الـ DNA التخليطي !!
(يعني المشكلة ليست في قلة عدد البروتينات والتي نسبتها 1 : 2500 : بل والطريقة نفسها كذلك غير دقيقة !!)

حيث قام أحد العلماء ويدعى ساريش Sarich باستخدام نفس التجربة بعد عامين على نفس البروتينات التي قاما بدراستها : ليكتشف أن مصداقية أبحاثهما مثيرة للجدل هي الأخرى !! وأن البيانات مبالغ فيها إلى حد كبير !! وأن نسبة التشابه أقل من ذلك بكثير !!
المصدر :
Sarich et al. 1989. Cladistics 5:3-32

فما رأيكم ؟؟
————————

4))
والآن – لنفترض فعلا أن نسبة التشابه (جدلا فقط وتنزلا معهم) هي 98.5% بين جينات الإنسان والشيمبانزي : فهل تعرفون كم عدد القواعد المشفرة الباقية من 3 مليار قاعدة في الحمض النووي للإنسان ؟!!

أن نسبة الاختلاف الضئيلة هذه (أي الـ 0.5 %) تساوي 150 مليون قاعدة !!!
وإليكم المفاجأة :

وهي أن نسبة التشابه – وبنفس طريقة التطوريين – بين جينات كل من الإنسان والفأر – أو تسلسل C57BL/6J هو 99 % !!!!

يعني أكثر من الشيمبانزي !! فهل الإنسان والفأر أبناء عم هم أيضا ؟!!!
أو لهم سلف مشترك قريب ؟!!
المصدر :
https://www.nature.com/nature/journal/v420/n6915/full/420509a.html
و :
https://journals.plos.org/plosbiology/article?id=10.1371%2Fjournal.pbio.1000112
و :
https://www.genome.gov/page.cfm?pageID=10005831

بل ونسبة تشابه جينات الإنسان والإسفنج المائي هي 70 % !! فهل نحن نشبه الإسفنج أو على نفس أفرع شجرة التطور معه ؟!!
المصدر :
https://www.digitaljournal.com/article/295662

والمضحك كذلك أن نسبة التشابه بين جيناتنا وذبابة الدروسوفيلا 60 % !!!!
فهل نحن نشبه الذباب أو تطورنا منه أو أولاد عم له أو أولاد خال حتى ؟!!
المصدر :
Hürriyet daily, 24 February 2000
https://www.genome.gov/10005835

ولمن أراد الاطلاع أكثر على هذه الصدمات المضحكة وعبثها بشجرة التطور المزعومة ومواقيت ظهور الكائنات عليها والتي صارت تتغير على الدوام : فيمكنه مطالعة الرابط التالي والذي ذكر نسب تشابه كثيرة بين العديد من الكائنات وذكر كذلك أنه هناك تشابه ((كبير)) بيننا وبين ديدان النيماتود وخصوصا في جسنات العضلات !!
الرابط :
https://www.thehumangenome.co.uk/THE_HUMAN_GENOME/Primer.html
مصدر آخر :
New Scientist, 15 May 1999, p. 27

حتى الديدان ؟؟!!
————————–———-

5))
لعبة الكراسي التطورية

حيث رغم تأكيد التطوريين دوما اننا والشيمبانزي أبناء عم على فرع واحد من شجرة التطور وأننا أقرب للشيبمانزي من الغوريلا مثلا : إلا أننا نجد الحقائق والاكتشافات في التشابهات بين الجينات في الحمض النووي تعبث لهم بكل هذه الأكاذيب وتكشف سماجتها يوما من بعد يوم !!
وهذا جزاء مَن زعم أن تلك التشابهات تدل على تطور ….

فقد أظهرت الدراسات وجود مناطق كبيرة من جينوم الإنسان والغوريلا متطابقة من حيث الإدراج والحذف : وغياب تلك العلاقة فى الشيمبانزى والذي من المفترض أنه أقرب للإنسان !!!

بالاضافه الى اكتشاف أكثر من 15% من التماثل بين الانسان والغوريلا واختلافهم بها عن الشيمبانزى فيما يتعلق بقدرات السمع التى من المفترض تطوريا أن الانسان تميز بها عن الشيمبانزى بعد الانفصال !!
فكيف يفسر التطوريون وجودها فى الغوريلا الأبعد تطوريا ؟!!!
كيف تظهر بالغوريلا ثم تختفى بالشيمبانزى ثم تظهر في الانسان ؟!!

والحقيقة أن الدراسات كلما توغلت في عالم الحمض النووي المذهل : اكتشفت اختلافات أكثر بين الإنسان والشيمبانزي !!!
وخصوصا في الكروموسومات الكبيرة مثل الكرموسوم الذكرى Y
حيث يختلف جذريا من حيث الهيكل والمحتوى الجينى
المصدر :
https://www.nature.com/nature/journal/v463/n7280/full/nature08700.html

وأما الشيء الجميل هو أن الحمض النووي للشيمبانزي يزيد بمقدار 12 % عن الحمض النووي للإنسان أصلا !!! يعني أقل شيء – والواحد مغمض العينين – أن يكون الاختلاف بينهما لا يقل عن 12 % ولو من جهة الشيمبانزي حتى !!

الجميل كذلك أننا لو تتبعنا نفس طريقة التطوريين في تلفيق التشابهات – فإن الشيمبانزي أقرب للدجاجة منه للإنسان !!! صدق او لا تصدق !!

حيث في مقال علمي في الساينتيفك أمريكان التطورية الشهيرة نفسها عدد ديسمبر 2009 وتحت عنوان غريب يقول :
ما الذي يجعلنـا بشرا ؟ WHAT MAKES US HUMAN

قامت الباحثة كاتبة المقال بدراسة متوالية DNA في أحد الجينـات ويُطلق عليه HAR1 وقامت بدراسة هذا الجين في كل من الإنسان والشمبانزي والدجاج – واكتشفت أن المتوالية للDNA بين الشمبانزي والدجاج تختلف في قاعدتين فقط من أصل 118 قاعدة بينما يصل الإختلاف بين الإنسان والشمبانزي إلى 18 قاعدة !!!
والنتيجة أن التطوريين يضحكوا على أنفسهم قبل أن يضحكوا على غيرهم – عندما يزعمون دلالة تشابهات الحمض النووي DNA وقدرته على التمييز بين الكائنـات الحية المختلفة !!
المصدر :
https://www.scientificamerican.com/article/what-makes-us-human/

فهل لا زلتم تثقون في التطوريين وإعلامهم الكذوب والبروباجاندا الخادعة : وكل مَن ينقل عنهم بغير تفكير ولا تمحيص ولا علم ؟!!
——————

6))
حسنا .. فإذا كانت الأبحاث والاكتشافات تكتشف الجديد كل يوم – فما هي آخر الأقوال في الاختلافات أو التشابهات بين جينات الإنسان والشيمبانزي ؟؟

هنا رابط بحث علمي منشور في الساينس ديلي يفسر كما ذكرنا في اول هذا المنشور سر التشابه في الحمض النووي بين الكائنات الحية بما فيهم الإنسان والشيمبانزي والقرود – وينزل بالتشابه إلى نسبة 90 % بدلا من 98.5 الشهيرة :
المصدر:
https://www.sciencedaily.com/releases/2012/11/121106201124.htm

وهذا رابط تنزيل دراسة أخرى حديثة ومذهلة من جامعة أكسفورد تقول أن 23 ٪ من الجينوم لدينا يختلف مع المعيار بين الإنسان والقرد :
https://mbe.oxfordjournals.org/content/24/10/2266.full.pdf+html

وهنا مقاله للدكتور ريتشارد بوغز Richard Buggs تحت عنوان :
70% شمبانزي ؟ 70% Chimp ?

حيث يقول أن التشابه الجيني بين الانسان والشمبانزي يصل الى 70% فقط !! ويكشف التدليس في النتائج التي يعلنها التطوريون من حين لآخر او تقليلهم للفارق متعمدين !!
الرابط :
https://www.refdag.nl/70_chimp_1_295967

وهذا رابط آخر من مجلة نيتشر الشهيرة نفسها (وهي من مناصري خرافة التطور) يوضح بعض هذه الاختلافات الحديثة المكتشفة بين الإنسان والشيمبانزي :
https://www.nature.com/nature/journal/v437/n7055/abs/nature04000.html

وبالطبع لن نعيد ذكر الدراسة التي ذكرناها في اول موضوعنا هذا وتتحدث عن 80 % اختلافات بين بروتينات الشيمبانزي والإنسان !!!
المصدر :
https://www.ncbi.nlm.nih.gov/pubmed/15716009

فهل تعجبتم بعد على عدنان وما يمرره من أكاذيب على الناس ومَن يثقون فيه للأسف ؟!
——————-

7))
مسك الختام والصدمة الأخيرة – والكبيرة – :
وهي انه فى ورقة للعالمان DURRETT R و SCHMIDT D التى تم نشرها فى عام 2007 بمجلة (علم الوراثة) بغرض التوصل الى استنتاجات نظرية حول المعدل الزمنى المطلوب لتثبيت الطفرات داخل المجموع السكانى لنوع من الاحياء عن طريق العمليات الحسابية ونماذج المحاكاة الحاسوبية :

وجد DURRETT , SCHMIDT أن الفترة الزمنية اللازمة لتثبيت طفرة واحدة فقط فى اسلاف الرئيسيات هى ستة ملايين سنة . وأن الحصول على إثنين فقط من الطفرات وثبيتها عبر التطور الدارويني للبشر هو ((100 مليون سنة)) !!

“FOR HUMANS WITH A MUCH SMALLER EFFECTIVE POPULATION SIZE, THIS TYPE OF CHANGE WOULD TAKE > 100 MILLION YEARS ”

ما الذى يعنية هذا ؟
مما سبق يتضح أمر غاية فى الوضوح بخصوص فاعلية معدل الطفرة فى التطور البشرى المزعوم وفشل الداروينية فى توفير الدعم النظرى بعد فشل الدعم التجريبى لإثبات قصة السلف المشترك !!

بعبارة أخرى، إذا كان تاريخ الانفصال التطورى الذى حدث بين الإنسان والشمبانزى من السلف المشترك قد حدث ما بين خمس لسبع ملايين سنة مضت كما يقولون ويزعمون ويؤلفون : فهذه الفترة التى من المفترض ان يختلف فيها الانسان عن الشامبنزى بما مقداره 35 مليون زوج من قواعد الحمض النووى عن طريق الطفرات هى بالكاد كافية لحدوث وتثبيت طفرة واحدة فقط !!!

فماذا لو علمنا أن تقديرات الوقت المتاح للحصول على اثنين من الطفرات اللازمة في طريق تطور البشر بحسب DURRETT , SCHMIDT هى 216 مليون سنة ؟! وهى طويلة بشكل غير طبيعي !!

وهذا يعنى ان الوقت الذى من المفترض ان تتطور فيه كل الثدييات على كوكبنا من ثدييى بدائى عاش فى هذا الوقت يتحصل فيه نموذج الوراثة السكانية على طفرتين فقط !!!

وماذا عن كافة الاختلافات بين البشر والشمبانزي ؟ كم من الطفرات يلزم للحصول عليها ؟ عشرات السنين ؟! مئات ؟! ملايين ؟!
تخيلوا كم من الوقت يلزم لوقوع تلك الخرافات – إن صحت أصلا – ؟
المصدر :
HTTPS://WWW.SCIENCEMAG.ORG/CONTENT/316/5833/1836.SUMMARY
و :
HTTP://WWW.NCBI.NLM.NIH.GOV/PMC/ARTICLES/PMC2581952/
و :
HTTP://BEHE.UNCOMMONDESCENT.COM/PAGE/4

فإذا نظرنا في ورقة علمية من موقع بلوس جينتكس الرابط التالي :
WWW.PLOSGENETICS.ORG/ARTICLE/INFO%3ADOI%2F10.1371%2FJOURNAL.PGEN.1002379

نجد أنه يوجد اكثر من 60 بروتين جيني مُشفر على الأقل ومتميز يفرق الانسان عن الشيمبانزي !! ولن يكفي 6 ملايين من السنين ليكون هناك تطور لهذه البروتينات ولا لـ 6 بليون سنه (البليون هو المليار) لن تكفي لتطور بروتين واحد !!!

IN FACT, 6 BILLION YEARS WOULD NOT BE ENOUGH TIME. THE EVOLUTION OF A SINGLE NEW PROTEIN, EVEN BY EVOLUTIONISTS’ INCREDIBLY OPTIMISTIC ASSUMPTIONS, IS ASTRONOMICALLY UNLIKELY, EVEN GIVEN THE ENTIRE AGE OF THE UNIVERSE TO WORK ON THE PROBLEM.
UNFORTUNATELY NONE OF THIS WILL INFLUENCE THE EVOLUTIONIST BECAUSE FOR EVOLUTIONISTS THIS NEVER WAS ABOUT SCIENCE



تحميل المقال كـ PDF عبر باتريون

التعليقات

اترك تعليق

avatar
  Subscribe  
نبّهني عن




المساهمون في الإعداد