×


هل نجح فريق الدكتور كريج فينتر فعلا في (خلق) خلية حية ؟!!

35263265



العجيب أن مَن يطلق مثل هذه الدعاوي الكاذبة والكلمات الخيالية مثل (خلق حياة) أو (خلق خلية حية لأول مرة صناعيا) إلخ : هو الإعلام أولا (والذي يتعمد دوما صياغة عناوين صادمة تصنع أكبر عدد من المشاهدات والزيارات إليه ليكسب منها في إعلاناته) – ثم يكررها نوعان من بعده :
1- إما ملحدون وتطوريون عالمون بهذا الكذب ولكنهم يكررونه للتأثير على المؤمنين
2- وإما جهلة عوام لا يفهمون في الأحياء ولا الأحياء الجزيئية أصلا كما تظهر حقيقتهم من أول نقاش علمي أو سؤال !!

وحتى لا نطيل عليكم – دعونا نشرح بالتبسيط ما الذي حصل – ثم نقرأ معا تعليق كريج فينتر Craig Venter نفسه عليه وكذلك علماء آخرين مختصون في علوم الأحياء !!
——————————–

1- مقدمة :
معلوم أن وحدة بناء الكائن الحي مثل البكتيريا والنباتات والأسماك والزواحف والطيور والإنسان إلخ : هي الخلية الحية الواحدة – فعلى قدر ما نجد أن أبسط كائن حي وهو البكتيريا يتكون من خلية حية واحدة فقط : نجد أن الإنسان مثلا فيه ما بين 60 إلى 100 تريليون خلية (التريليون هو مليون المليون) !!

وكل الخلايا الحية تحتوي على لغة وشفرة عمل داخلها تقول للخلية ماذا ستصنع لتكون جسد الكائن الحي (سواء كان الكائن بسيط كالبكتيريا أو معقد كالإنسان حيث نجد عشرات الأنواع من الخلايا داخل جسده) – هذه اللغة وهذه الشفرة الوراثية اسمها DNA – وتتكون بصفة أساسية من حروف هي التي ستعطي اوامر التكوين للجسم والبروتينات – هذه الحروف هي قواعد كيميائية يرمز لها العلماء بأربعة حروف هي : ATCG

إذن : تتابعات هذه الحروف داخل خلايا الكائن الحي تعطي اوامر (نسميها جينات) – وذلك يكون بترتيب معين مثلا كالآتي :
CGTAGCATGACACTGACAGCATGCATGCATGCGTAGACG

ويوميا : يتم نسخ العشرات والمئات والآلاف من هذه الجينات داخل خلايا كل كائن حي (على قدر تعقيده) : ليتم إرسال ما تم نسخه ليتحول إلى البروتينات المطلوبة في الجسم أو الخلايا

ومنذ عشرات السنين القريبة فكر العلماء في استغلال هذا الكائن البسيط (البكتريا) في فوائد علاجية للبشر والحيوان والنباتات – وخصوصا لاحتواء الحمض النووي للبكتريا على جزء منفصل اسمه (البلازميد) Plasmid – والذي يمكن أن تمرره البكتريا من بعضها إلى البعض في وقت قياسي وسريع للنسخ – وهو الباب الذي فتح على مصراعيه المجال أمام تقدم كبير في الأدوية والعلاج والطب والصيدلة والتهجين وتحسين مواصفات النباتات إلخ وهو ما يسمى اليوم بالتقانة الحيوية biotechnology وخصوصا في تصنيع الأدوية :
Use of biotechnology in pharmaceutical manufacturing

فمثلا هرمون الإنسولين الذي يحتاجه ملايين البشر المصابون بمرض السكري – كانوا في البداية يقومون باستخلاصه من غدة البنكرياس للماشية وحيوانات المزرعة ليستفيد منه الإنسان الذي يحتاجه – ولكن مع التقنية الحيوية أمكن نسخ جينات تكوين هذا الهرمون ولصقها في داخل بلازميد البكتريا (إشيرشيا كولاي تحديدا أو القولونية) وهي ستتكفل بنقله وتكثيره ونسخه في عشرات الآلاف من البكتريا الأخرى خلال بضعة ساعات فقط !!

ونفس الشيء بالنسبة لهرمون النمو البشري … وهكذا
وبهذا بدأت الثورة فيه على يد شركة جينيتيك Genentech الأمريكية 1978/ 1979م – يعني له أكثر من 30 سنة معروف ويدرسه طلبة الجامعات الطبية والصيدلة والأحياء الدقيقة والبيولوجيا الجزيئية إلخ !! ولذلك :
لا نجد مثل هذه العناوين المضللة التي صاحبت إنجاز فريق معهد د. كريج فينتر J. Craig Venter Institute (JCVI) : أي أثر عند العلماء الحقيقيين : فضلا عن طلبة الكليات المتخصصة أنفسهم !!

فقط العوام والبسطاء والملاحدة والتطوريين هم الذين يهللون لمثل هذا التلاعب الإعلامي في العناوين التي تصنع جدلا !!
————————————–

2- ماذا فعل فريق معهد د. كريج فينتر (JCVI) بالضبط ؟
الإنجاز الذي صنعه فريق معهد د. كريج فينتر (JCVI) في مايو 2010م وهلل له الملاحدة والتطوريون مع الزخم الإعلامي المتلاعب في عناوين الأخبار : كان أنه ولأول مرة يستعين بتقنيات الكمبيوتر في نسخ (لاحظوا نسخ لموجود وليس اختراع جديد ولا خلق) : نسخ ترتيب قواعد حمض نووي كامل DNA من بكتيريا (التي هي أصغر كائن حي أصلا من خلية واحدة !!) ووضعه في خلية بكتيرية أخرى بعد تفريغها من الجينات المسؤولة عن الإنزيمات المحددة Res genes وذلك لأن هذه الإنزيمات المحددة Restriction enzymes هي التي تساعد الخلية على التمييز بين الحمض النووي الخاص بها وذلك الذي لا ينتمي لها – وحذف أو معالجة هذه الجينات أو الإنزيمات المحددة – بدوره – ليس جديدًا في الهندسة الوراثية !!

وهكذا بدأت هذه الخلية البكتيرية الثانية في التعامل مع الحمض النووي الجديد كأنه حمضها النووي وبدأت تنسخه وتتكاثر به !!

والسؤال :
أين (رائحة) الخلق هنا أو (إبداع) شيء جديد عما كان يتم من قبل في مجال البيولوجيا الجزيئية ؟!! حتى البكتريا الأولى والثانية هما نوعان متقاربان في الشكل جدا من البكتريا حتى أنه يصعب على الدارس نفسه التفريق بينهما بالعين المجردة !!
الأول هي بكتريا M. mycoides
والثانية هي بكتريا Mycoplasma capricolum
وفضلا عن أنه لا جدار خلوي لهما وأن حمضهما النووي صغير جداً أصلاً (قارنوا ذلك بالسنوات التي قضاها معهد د. كريج فينتر (JCVI) في إنجاز ذلك فقط) !!

إذن : الإنجاز الحقيقي لمعهد د. كريج فينتر (JCVI) كان في (حجم) العمل هذه المرة (وهو نقل حمض نووي كامل من بكتريا لأخرى) !! وليس في نوعيته إذ طلبة ودكاترة الكليات العملية والأحيائية يقومون بمثل ذلك النقل في معاملهم الحيوية يوميا !!
بل إن إيكارد ويمر Eckard Wimmer البروفيسور الألماني الأمريكي من جامعة ستوني بروك Stony Brook University قد قام من قبل في عام 2002م بتركيب الأطلس الوراثي لشلل الأطفال في بكتريا وحقنه لفئران تجارب – فتجربة البروفيسور إيكارد ويمر كان حجمها 7500 جزء فقط – ولكن حجم ما نجح فيه معهد د. كريج فينتر (JCVI) يفوقه تقريباً بـ 100 ضعفا !! وهذا هو سر التميز لا أكثر ولا أقل !!
ولا خلق ولا يحزنون !!
ولا إبداع ولو شفرة بروتين واحد حتى جديد !!
بل :

ولا علاقة لكل ما حدث بمكونات الخلية الحية نفسها !! وذلك لأن ما يلعب فيه كل الدكاترة والباحثون وكريج فينتر وغير كريج فينتر : هو جزء صغير جدا من الخلية الحية وهو الحمض النووي الوراثي الذي بداخلها DNA !! وهو مثلا كبيت العمدة داخل مدينة كاملة فيها مصانع وشبكة مواصلات وطرق وتغذية إلخ إلخ إلخ !!
هذا فيديو لنا من قبل عن الإعجاز في داخل عالم الخلية الحية المبهر :

ولذلك نجد أقوال وتعليقات المختصين : لا صلة لها بالبروباجاندا الهائلة التي تم صناعتها للاستفادة الإعلامية والإلحادية والتطورية من الخبر !!
—————————————

3- أقوال الخبراء والمختصين وكريج فينتر وفريقه !!
يقول كريج فينتر Craig Venter نفسه :
” نحن نسمي هذا صنعًا لأن الخلية مأخوذة من كروموسوم مصنع من مواد كيميائية تم تصنيعها عن طريق معطيات الحاسوب ”

المصدر : 1

ويقول بين دافيز Ben Davis من جامعة أوكسفورد :
” يمكنك أخذ هذا الجينوم الصناعي وتضع فيه جيناتٍ جديدةً تمثل وظائف معلومة ولكن هذا لا يختلف في شيء عن البيولوجيا الجزيئية في الوقت الراهن ”

المصدر : 1

بل العجيب أن بعض تفاصيل ما حدث ليس معروفا على وجه الدقة للعلماء أنفسهم !! يقولون كما ورد في خبر الواشنطن بوست :
” بعض أجزاء العملية مازال غامضًا بالنسبة للعلماء ” !!

المصدر : 1

ومن نفس الرابط نقرأ تعليق دانيال جيبسون Daniel Gibson :
” لا نعرف بالضبط ما حدث أثناء عملية نقل الجينوم ” !!

جدير بالذكر ان دانيال جيبسون نفسه في مقال على موقع معهد د. كريج فينتر (JCVI) نفسه كتب :
” نستطيع الآن البدء في تصنيع خلية بها الحد الأدنى من الجينات المطلوبة للحياة لنفهم عمل الخلية بطريقة أفضل ”

المصدر : 1

ومَن يفهم هذا الكلام : يفهم ما الذي حدث بالضبط من تكرار الضجة مؤخرا هذا العام 2016م حول ما فعله من جديد معهد دكتور كريج فينتر (JCVI) في محاولة الوصول في بكتريا إلى أقل حد ممكن من الجينات اللازمة لبقائها (ومن جديد : الأمر ليس فيه أي رائحة للخلق ولا يحزنون وإنما استقطاع واستبعاد للجينات والتجربة والخطأ إلى حد الوصول إلى أقل تكوين لحمض نووي للبكتريا تستطيع به التكاثر) !!
فلما نجح في اختصار بكتريا إلى الحد الذي استطاعه : واستطاعت البكتريا بالفعل من التكاثر : هلل الإعلام والملاحدة والتطوريون من جديد أن الرجل استطاع (خلق) بكترية كاملة تتكاثر !! أو : (خلق) أول كائن حي صناعيا قادر على التكاثر !!

وهنا ترون مدى الهلوسة والجنون لدى القوم وبينهم وبين كلمة (خلق) التي يصرون على حشرها في كل شيء يرون أنه يمكنه زعزعة الخلق الإلهي في أعين المؤمنين بخالق سبحانه !!
—————————————-

وأخيرا وحتى لا نطيل عليكم :
هذه بعض المقولات الأخرى المنوعة مع مصادرها ونصها الإنجليزي :

يقول كريج فينتر Craig Venter في حديثه مع الس إن إن :
” فينتر : نحن صنعنا خلية جديدة – هي حية – ولكننا لم نخلق حياة من الصفر ” !!
Venter: We created a new cell. It’s alive. But we didn’t create life from scratch

المصدر : 1

ويقول جيم كولينز Jim Collins المتخصص في الهندسة البيولوجية في جامعة بوسطن :
” إن ما يقلقني هو أن بعض الناس سيتوصلون إلى استنتاجات بأنهم خلقوا شكلا جديدا من أشكال الحياة “.
My worry is that some people are going to draw the conclusion that they have created a new life form
وأضاف :
” إلا أن ماخلقوه ليس سوى جسم حي يحتوي على جينوم طبيعي تم تركيبه صناعيا. وهذا لا يعتبر خلقا للحياة من العدم، أو خلقا لشكل جديد من أشكال الحياة ”
What they have created is an organism with a synthesized natural genome. But it doesn’t represent the creation of life from scratch or the creation of a new life form

المصدر : 1

ويقول بول نيرس Paul Nurse عالم الأحياء البريطانى الفائز بجائزة نوبل :
” عمل فنتر إنجاز كبير..ولكنه ليس خلقا لحياة صناعية..خلق حياة صناعية يتطلب تصنيع خلية كاملة من مواد كيمائية ”
Venter’s work is a major advance. But it’s not a creation of synthetic life…Creation of synthetic life would be to make an entire bacterial cell through chemicals

المصدر : 1

ويقول أندى الينجتون Andy Ellington عالم احياء تصنيعية بجامعة تكساس :
” البكتيريا ليس فيها روح..ولم تتغير أى من وظائفها فى هيئتها الصناعية “The bacteria didn’t have a soul, and there wasn’t some animistic property of the bacteria that changed

المصدر : 1

ويتحدث بى جى راو BJ Rao رئيس معهد مومباى للأبحاث الأساسية في لقاء معه عن أن هذه التجربة يمكن مضاهاتها بزرع الأعضاء ولكنها لا تضاهى خلق خلية..الخلية الجديدة ببساطة تحمل مادة وراثية صناعية، ولكن كل مكوناتها الأخرى نشأت من الخلية الأصلية الطبيعية .. وأن التفكير في صنع المكونات الأخرى للخلية هو أبعد مما نقصد بكثير :
the experiment can be equated with organ transplantation, where the defective organ can be transplanted with a fresh one.
This is not the equivalent of really creating an artificial cell in its entirety. [Craig] Venter’s new cell simply carries an artificial genome, but all its other components are from the recipient cell and are natural. Artificially creating those other components is beyond our current means

المصدر : 1

ويقول ديباك بنتال Deepak Pental عالم تقنيات الأحياء ونائب رئيس جامعة نيودلهى :
” فى حالتنا هذه..الخلية الأصلية ينظر لها على أنها مجرد هيكل يحتوى على المادة الوراثية المصنعة ولكن الخلية الأصلية فى الحقيقة أعقد بكثير من كونها مجرد هيكل ”
In this case, the bacterial cell is being seen as a shell, an envelope into which man-made genome is inserted. But the shell is much more than an envelope

المصدر : 1

ويقول ديفيد بالتيمور David Baltimore عالم وراثة بمعهد كاليفورينا للتكنولوجيا :
” أعتقد أن كريج فنتر بالغ فى أهمية إنجازه..إنه لم يخلق حياة..فقط قلدها ونسخها ”
To my mind Craig has somewhat overplayed the importance of this
He has not created life, only mimicked it

المصدر : 1



تحميل المقال كـ PDF عبر باتريون

التعليقات

اترك تعليق

avatar
  Subscribe  
نبّهني عن




المساهمون في الإعداد